Appears to have an egg bundle suspended in its web
Macro photos courtesy of @rhiannonsf
eBird reviewer said it wasn't a bird. Any mammal experts out there have an idea?
Found under brush on a bank along the trail.
Managed to help it out of the large pot it had got trapped in.
In Tilden Park on dead Bay Laural. I originally thought it was a Stereum sp. but it looked a little different, and the host was usual. The specimen, which was almost completely resupinate, pealed off easily from the wood. The first photo is the dried specimen, the next two are dissection scope views. Cystidia are at 400X, spores at 1000X. Spores 7 X 11 (ave of 5), with a transparent outer part. Cystidia numerous, thickwalled, and incrusted with crystals. Clamp connections occasional. The ITS sequence is a nearly exact match:
AAGGATCATTAACGAGTCTTGAAAGGGTTGTAGCTGGCCTCCCGAGGCACGTGCACGCCCGCTCATCCGCTCTACACCTGTGCACCATTGTAGGTCGGTCGTGCGGGCGCCCCTCTTCTGGGGCGCTCGAGCGGTCTTCCTATGTAACACCACACACCATGCAGTATCGGAACGACGACGCGATAATACGCATCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTCGGTATTCCGTGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAAACCCCTATCCCTTGTGGAGAGCGGGCTTGGACTTGGAGGCTTGCCGGCCGTCGTGGTCGGCTCCTCTCGAATGCATCAGCTCGATTCCTTGCGGATCGGCTCTCGGCGTGATAATTGTCTACGTCGTGACCGTGAAGCGTCTGGCGGGCTTCTAACCGTCCCTTCGAGGACAACCCTTCGAATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA
Stems and caps somewhat fluorescent in 365 nanometer ultraviolet light. Spores not so much, but young gills glow brightly.
bioluminescent gills
Natural History of UCSC Campus, Fall 2017, Professor Ryan Carle
Update on 1/27/2020:
The habitat was a wooded riparian strip along a levee adjacent to agricultural fields at the edge of the Sacramento Bypass Wildlife Area.
Three photos have been added
When I cut it in half it quickly stained dark blue. Later that evening the blue disappeared, however it reappeared again when I scraped it with a knife. The odor and taste of both the cap and stipe were mild and indistinct. It was medium firm and was moist, but not at all slimy.
A family of San Joaquin Kit foxes including an adult male and female with 6 pups was seen on 2 consecutive days. A photo is of a pup with a Yellow-rumped Warbler, Dendroica coronata.
Also photos of the adults, pups and a den.
Host plant is a Eucalyptus globulus .
In median in parking lot of apartment complex.
Eggs like these were mostly scattered inch or more apart; this is a rare clump. Under (I think) cattail fronds in moist area (usually would have standing water this time of year). Each egg approx 2mm long.
Let's consider this to be an observation of the lower spider; see other observation for the top spider.
Could this be A. asmodaeus (Bond, 2012: known only from type locality Mt. Diablo)?
Est. 2cm BL, found in oak/mixed duff by @leftcoastnaturalist. It was non-responsive, so dead (but soft/flexible) or doing a very good job at playing dead.
More photos at https://bugguide.net/node/view/1476644/bgimage
Not sure on ID, but there were a couple of these guys.
Possible cougar marks in the trail - in what was mud at the top of a steep ravine.
Iridescent Green Skin.
Wings have a black frosty striped pattern.
Lower part abdomen moves and down to groom itself.
It is next to a road on an invasive berry plant.
So many of them!
I suspect this is Promyrmekiaphila, but I can't really see the cymbium, let alone any dorsal spines thereupon.
Found by Daniel Schmelter and co. on cave wall near "Main Hall"
http://i.imgur.com/fmWxoSa.jpg
"Tissue" sampled into CTAB.
Update/edit: I don't think this is fungal, or any other sort of living thing. I think it's glow-in-the dark latex/rubber/goo who-knows-what
Found underneath log, along with several other voles.
G. californicum, presumably
This was on the ceiling inside my house right above where I work. It was about 2" wide, including its legs, so the main part of it was about 3/4". I photographed it right where it was found on the ceiling, and then my son trapped it in a plastic cup before relocating it outside, and I photographed it in the cup with a white paper towel in the background, which made the details stand out. I couldn't get a shot of its eyes straight on, but it looks from my angle above it in the cup that it had 8 evenly spaced eyes. @rjadams55 , is this a Liocranid? Are those long tarsal claws on its hind legs or not? I was looking at plate 29 on your book, and some of the spiders on that page look similar, but they seem like they are smaller than the one I saw. There's this spider that looks similar (hard to tell w/the quality of this photo) that was also seen in SLO: http://bugguide.net/node/view/488050
Found in the Mud Flats at Crab Cove; ~2 inches long.
What an awesome find
Habitat: Roadside, Oak Woodland
Substrate: Duff
Cap: 5.5" (14 cm) h x.75" (2 cm) thick, plane, pale butter yellow, translucent, dry, striated at the margin, white warts, sparser toward the center, white flesh, did not discolor, mild smell
Gills: white, adnexed, no latex, no bruising
Stipe: 4" h (10 cm) x 1-1.75" (2.5-4.5 cm) thick solid white, smooth, dry, tapered at the top, pronounced basal bulb, looks like an egg cup (volva), no ring present, no bruising, mild smell, snapped like chalk, very short striations at the very top of stipe
Records on Mushroom Observer of this specimen including spore data: http://goo.gl/vxiYz2
This substantial mushroom was about 7-10 cm high and wide. According to Christian Schwarz, who examined this under a microscope, this is the first record of the genus Entocybe in Santa Cruz county (at least on iNaturalist). Proposed names: Entocybe trachyospora, Entocybe trachyospora var. purpureoviolacea
Please see my original post on Mushroom Observer: http://mushroomobserver.org/observer/show_observation/197555
Found growing on a possibly diseased plum tree.
Tons of these under a log in a drier part of the marsh. Never seen so many. And are those pseudoscorpion eggs?
This one used lichen in its turret construction, a choice that we endorsed whole-heartedly. Also, Trent is the best turret tickler ever.