Photos / Sounds

Observer

bit

Date

April 14, 2024 10:48 AM PDT

Description

Pisgah 2019 fire. On the underside of a big burnt oak log

Photos / Sounds

What

Pepper Pot (Myriostoma coliforme)

Observer

thomasroehl

Date

September 29, 2021 09:52 AM CDT

Description

Large for the species: heads ~6 cm across, rays ~10 cm across. Not collected by me, but I got the approximate location of where it was found.

Photos / Sounds

Observer

thomasroehl

Date

April 17, 2021 01:11 PM UTC

Description

Growing on and deforming gills of Flammulina velutipes. Colony white and fluffy on PDA, producing thallic conidia. In culture, producing thick bundles of mycelium.

Photos / Sounds

Date

December 2023

Description

Rabbit dung. @werdnus have you ever seen something like this? F000208

Photos / Sounds

What

Coral Fungi (Genus Ramaria)

Observer

ninamp

Date

May 26, 2018 10:56 AM AEST

Description

By Sella River along trail.

Photos / Sounds

What

Luminous Porecap (Favolaschia manipularis)

Observer

zia_crytser

Date

May 19, 2022 11:54 AM ChST

Photos / Sounds

Observer

mgkoons

Date

December 17, 2023 12:26 PM PST

Description

On 150+ year old Thuja plicata, KOH reaction red, red-orange (pictured in close up of collection)

Pores .75-1 per cm, with white sebiculum, microscopy pending

Photos / Sounds

Observer

alan_rockefeller

Date

August 31, 2012

Description

The cap has an interesting crunchy texture.

Growing on well decayed wood.

Spores smooth, inequilateral, 10.5 – 13 × 5 – 6.5 µm, with 1 or 2 oil droplets per spore. 8 spores per ascus. Asci walls invisible in KOH.

Spore measurements:

10.6 [11.4 ; 12] 12.8 × 4.8 [5.5 ; 6] 6.6 µm

Q = 1.7 [2 ; 2.2] 2.4 ; N = 15 ; C = 95%

Me = 11.7 × 5.7 µm ; Qe = 2.1

Photos / Sounds

What

Wine Glass Fungus (Podoscypha petalodes)

Observer

magpie_anomica

Date

October 2, 2023 10:51 AM EDT

Photos / Sounds

What

Stalked Puffballs (Genus Tulostoma)

Observer

wildwestnature

Date

March 2, 2024 11:05 AM CST

Description

Sand prairie

Photos / Sounds

Observer

corndog

Date

November 6, 2021 03:47 PM PDT

Photos / Sounds

Observer

lostcoastmike

Date

December 15, 2023 01:11 PM PST

Description

Spores 4-4.5 x 2.2-3 µm.
On a huge standing dead Madrone. Does not key out. Some obscure polypore. . . .
Small pores 2-3/mm.
Trametes-like, but no hair and spores are quite different.

Photos / Sounds

Observer

true_islander

Date

December 18, 2023 02:17 PM PST

Description

Growing on salad branch.

Photos / Sounds

Observer

chael

Date

October 30, 2017

Photos / Sounds

Observer

corndog

Date

October 1, 2022 11:02 AM PDT

Photos / Sounds

Observer

cizon77

Date

October 9, 2019

Description

Cuphophyllus #930
Photo#2 - pileipellis

Caps - 2 1/2 - 5 1/3 cm wide, convex to plane with irregular margins and some with sunken discs. Viscid at first, matte when dry. Tan becoming pale brown at disc. Randomely pock-marked.
Gills - Decurrent, arcuate, waxy,subdistant. Buff with a faint pale orenge tinge when observed sideways. Four tiers of lamellulae. Edges entire.
Stipe - 3-4 cm long and 7-9 mm thick. Canescent buff pruina on a watery tan ground. Base clavate.
Some white velar material at base. White canescent line at apex.
Odor & Taste - Mild.
Spores - White, inamyloid.
Habitat - Scattered under alder at Geneva Lake at the Stimpson Family Reserve on October 9, 2019.
Spores - Ellipsoid in face view, slightly dacryoid in profile. 7-9 x 4-5 microns. One large pale gray-blue oil drop in most. Q = 1.89.
Basidia - Clavate, 2 and 4-spored. 25-31 x 7-8 microns.
Gill Trama - Of interwoven hyphae.
Clamps - Present in pileipellis, stipitipellis, bases of basidia, and gill trama.
Pileipellis - Of interwoven hyphae 2-4 microns wide.
Pileal trama - Of radially parallel hyphae 4-10 microns wide.
Oleiferous hyphae - Present in stipitipellis.
Stipitipellis - Of vertical hyphae 3-10 microns wide.
Caulocystidia - Nests of branched and filiform hyphae with golf club (subcapitate) apices. 3-5 microns wide.
Comment - Close to Cuphophyllus borealis which differs by having a cutis of radially parallel hyphae for a pileipellis.

Photos / Sounds

Observer

jackjohnsonn

Date

September 15, 2023 12:12 PM PDT

Description

Peat dwelling small yellow Clavaria. Maybe something close to the description of C. argillacea. Fruitbodies ~.8-2cm
No color reaction in short wave UV.

Photos / Sounds

Observer

ben_ertle

Date

November 24, 2023 01:34 PM HST

Photos / Sounds

Observer

mycoscope

Date

May 4, 1996

Description

In rainforest

Photos / Sounds

Observer

johnplischke

Date

September 6, 2010

Photos / Sounds

Observer

brucen

Date

January 18, 2020 03:07 PM PST

Description

Put on top of a stick for photos. Grew on the side of a conifer.

Photos / Sounds

Observer

mgkoons

Date

September 17, 2023 12:49 PM PDT

Description

Non-bluing Hymenogastraceae growing on wood in a dry stream bottom primarily with Salix and Alnus

Photos / Sounds

What

Western Hardwood Sulphur Shelf (Laetiporus gilbertsonii)

Observer

leptonia

Date

September 11, 2020 08:50 AM PDT

Photos / Sounds

Observer

melodydodderer

Date

October 10, 2022 11:23 AM PDT

Photos / Sounds

Observer

canyonus

Date

December 18, 2020 10:32 AM PST

Photos / Sounds

What

Shelf Fungi (Order Polyporales)

Observer

stelcook22

Date

June 16, 2023 04:14 PM PDT

Description

bracket fungi growing on dead snag near fragrance lake in WA, mostly white with colorful gooze coming out of it

Photos / Sounds

What

Bonnets (Genus Mycena)

Observer

taraseverns

Date

July 29, 2023 11:07 AM HST

Photos / Sounds

What

Golden Oyster Mushroom (Pleurotus citrinopileatus)

Observer

cuevo

Date

June 19, 2023 12:51 PM PDT

Description

Fungus Fruiting. Growing in bark mulch.

Photos / Sounds

Observer

lizziepop

Date

January 27, 2022 09:23 AM SAST

Photos / Sounds

What

Clown Tree Frog (Dendropsophus leucophyllatus)

Observer

davidascanio

Date

October 20, 2022 01:49 PM -04

Photos / Sounds

What

Lilac Dapperling (Cystolepiota bucknallii)

Observer

lauren_re

Date

October 21, 2018 01:34 PM PDT

Description

The rare Purple Powdered Fume Cap

Photos / Sounds

Observer

bellaormseth

Date

June 12, 2023 12:05 PM PDT

Description

This weird thing reminded me or orchid roots or some sort of finger fungus. It seemed to be growing from Vaccinium parvifolium, the red huckleberry. Found in a second growth conifer forest.

Photos / Sounds

Observer

betweenthelyons

Date

May 2023

Description

K-, slightly sweet scent, Doug fir

Photos / Sounds

Observer

rudydiaz

Date

May 2023

Description

High elevation chaparral and mixed forest, Pseudotsuga macrocarpa, Pinus ponderosa, Quercus chrysolepis, Hesperoyucca whipplei.
Growing on leaves and twigs submerged underwater ~4 in deep in mildly turbulent stream from snowmelt runoff. Area had been covered in snow two weeks previously, but it was absent at the time of the observation, with last traces visible in between peaks at the highest elevation.

Most caps clearly developing and expanding underwater; others starting above water out of saturated margins of the stream. “Aquatic” caps bursting through layer of algae on surface of the water, but no algae on the underwater substrate.

Underwater caps alabaster at button stages, expanding to brown with white cracked pattern. Above-water caps more dome-shaped, velvety, zonate. Both hygrophanous. Gill margins white; consistent feature.
Stipe lacking annulus, extraordinary flexible for Psathyrella. Rigid inner layer (revealed by microscopy to be a dark conglutination) and a squishy, plastic-bag-like outer layer (consisting of lighter hyphae in pyramidal ridges).

Spores deposit purple black.
Spores cigar brown. KOH+ fuscous. With apical pores. [11.8] 12.25-13.18 [13.9] x [6.2] 6.62-7.2 7[7.8] μm
Q [1.71] 1.74-1.89[2]

Spores measured from spore print deposited from mushroom cap that developed underwater; evidence for this is the presence of diatoms in the cross section of this mushroom.

On this same cross section are spores that appear to have germinated on the gills.

Photos / Sounds

Observer

corndog

Date

April 17, 2023 03:21 PM PDT

Description

On raised sphagnum hummocks in poor fen. Fruiting bodies 1-2 cm

Spores globose, 10microns

Photos / Sounds

Observer

rosawoodsii

Date

January 2022

Place

Oregon, US (Google, OSM)

Description

Dog-found in the Holiday Farm Fire burn area (burned in Sept 2020). Douglas fir forest with a few incense-cedars. Burn low to moderate severity. Spores larger than an Oregon black truffle's spores and refuse to squash free from the flesh. White latex when cut. Fruit body was very firm/dense.

Photos / Sounds

What

Blushing False Truffle (Rhizopogon roseolus)

Observer

abe

Date

September 13, 2014 04:08 PM PDT

Photos / Sounds

What

Funnels (Genus Clitocybe)

Observer

rudydiaz

Date

March 3, 2023 02:48 PM PST

Description

Cap cream, convex to plane. Gills clitocyboid. Young specimens with vellipellis. Odor farinaceous. Growing on dead live oak.

Photos / Sounds

What

Chytrids (Phylum Chytridiomycota)

Observer

leptonia

Date

April 2, 2023 03:29 PM PDT

Description

maybe?? On Blennosperma

Fungi

Photos / Sounds

What

Hongos (Kingdom Fungi)

Observer

harsiparker

Date

March 1, 2023 12:55 PM PST

Description

~1 mm growths attached to dangling dead portions of a Salmonberry stem. I checked back on these a few weeks later and they remained unchanged in appearance. Currently stumped as to where to even start in narrowing down the ID -- any and all ideas would be awesome!

Photos / Sounds

Observer

giulioz

Date

February 6, 2023 04:33 PM -05

Description

???

Photos / Sounds

Observer

warren_cardimona

Date

January 30, 2022 04:31 PM PST

Photos / Sounds

What

Artist's Brackets, Reishi, and Allies (Genus Ganoderma)

Observer

suillusjoe

Date

April 12, 2020 01:09 PM HST

Description

Occurring on old Ohia(Metrosideros p.)stump, native forest. Multiple fruiting bodies in various stages. Quickly staining brown with touch/pressure. Location approximate, no microscopic data.

Photos / Sounds

Observer

arielbonkoski

Date

November 15, 2022 12:52 PM CST

Description

On cedar

Photos / Sounds

Observer

christrent

Date

December 2022

Photos / Sounds

What

Cataleptic Lebbeid (Lebbeus catalepsis)

Observer

crabsandshrimps

Date

July 30, 2017 11:29 PM PDT

Photos / Sounds

Observer

corndog

Date

October 8, 2022 11:54 AM PDT

Description

/Marasmiaceae. Tough fruiting bodies, thickened stipe apex, on wood, odorless

Photos / Sounds

Observer

johnplischke

Date

September 23, 2022 08:16 AM EDT

Photos / Sounds

Observer

chyroptera

Date

February 20, 2023 02:49 PM PST

Description

On old stem of nettles (Urtica sp.)

Photos / Sounds

Observer

else

Date

January 14, 2022 11:41 AM PST

Description

on bark of living Quercus kellogii.
first three photos by @milavth

Photos / Sounds

Observer

ym_wang_pnw

Date

January 16, 2023 01:54 PM PST

Photos / Sounds

Observer

heavykevy13

Date

February 18, 2023 12:53 PM EST

Photos / Sounds

Observer

michele36

Date

January 2023

Photos / Sounds

Observer

corndog

Date

October 2, 2022 06:49 PM PDT

Description

Strange one, I thought it was Tubaria..

on soil, with alder, blue under UV. collected

Photos / Sounds

Observer

corndog

Date

October 2, 2022 04:28 PM PDT

Description

on sedges in fen

Photos / Sounds

Observer

dannymi

Date

July 28, 2016

Description

Photo and collection by Andrew Parker. On conifer litter.

Photos / Sounds

What

Veiled Panus (Tectella patellaris)

Observer

autumna

Date

November 15, 2020 01:48 PM PST

Description

I am going to need some help on this one. I have never seen anything like it, nor has my mushroom ID group.
Growing on an Alder log in a mixed (mostly deciduous forest).
They were growing like from rudimentary stipes with the caps hanging below. They were also fruiting in pairs growing at different rates. I harvested two pairs.
Under the bell shaped "cap" are a round of "gills".
These specimens were 1 cm wide by 2 cm long. The outside was EXTREMELY viscid. I could barely hold on to them and the slime dried to my slide that I was trying to get a spore print off of.
Spore print white.
Spores were really tiny, they reminded me of T. versicolor. These spores are a sausage shape with two guttules at either end of the spore. I have mounted the spores in DI water at x100 and x400. I have some other random microscopy images of some of the gill trama, I was looking for basidia, but was unable to find any. I do think I found cystidia though.
I have the dried specimens stored and labeled.

Sequenced on 3/3/21 by FunDis:

Nucleotide Sequence

CTGCGGAGGATCATTATTGAATCAAGTTTGAAACGGTTGTTGCTGGCCTCTTGCGGGCATGTGCACACCTTTCAAAATTATTCTACAACCACCTGTGCACCTTTTGTAGACCTGGGATACCTCTCGAGGCAACTCGGATTTGAAGGGCTGCGGGCTTCTCTCAAGAAGTCGGCTCTCATCTCACTTCCCTGGTCTATGTTTTTATATATACCCTTTTTAAAAATGTTACAGAATGTCATAAGCGGTCTGCTTGCAGACTTTAAATTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCATTCCTGTGGTGACACATGGAGTTGGCTTGGAAGTGGGGGCTGCGGGCTTCTTTCAGAAGTCGGCTCCTCTTAAATGCATTAGCAGAACCTTTGTGGGCCTGCCCTTGGTGTGATAATTATCTACGCTCTGGGTTGGAACACAGATTTACATGGGGTTCAGCTTCTAACTGTCTTTTTT

Photos / Sounds

What

Basidiomycete Fungi (Phylum Basidiomycota)

Observer

jackjohnsonn

Date

November 18, 2021 11:22 AM PST

Photos / Sounds

Observer

organicgardner44

Date

January 14, 2023 11:54 AM PST

Description

Grows loosely attached to bark on living Quercus garryana. Hymenium lacks pores but looks finely granular probably due to very large basidia (up to 50 microns beyond rest of hymenium and long sterigmata (10-20 microns long. Spores are amyloid, roughened, thick-walled with refractive content, average 15.9 x13.8 microns. They have a small pip. Another possibility is Aleurocystidiellum. No good species match.

Fungi

Photos / Sounds

What

Hongos (Kingdom Fungi)

Observer

lumenal

Date

January 23, 2023 10:57 AM PST

Description

Lichenicolous fungi on Parmelia

Photos / Sounds

What

Oakmoss Spot (Unguiculariopsis lettaui)

Observer

lumenal

Date

January 23, 2023 11:00 AM PST

Description

Lichenicolous fungi on Evernia prunastri

Photos / Sounds

Observer

corndog

Date

January 21, 2023 09:48 PM PST

Description

On dunegrass

Photos / Sounds

What

Hanging Millipede Liverwort (Frullania nisquallensis)

Observer

sadie_hickey

Date

October 23, 2019

Photos / Sounds

Observer

tropicmycoprof

Date

September 11, 2021 06:19 PM HST

Photos / Sounds

Observer

suillusjoe

Date

January 23, 2022 10:52 AM HST

Description

Growing out of mango wood chips, gregarious,

Gills: free crowded, butter colored. Lamellulea: 3 series
Stipe: hollow, tapering upward from sub-bulbous squamulous base, stipe staining readily reddish orange and fading to grey brown.

Annulus present.

Cap: 15-70mm convex to pano convex, white with brown/Black concentric scales/dots radiating from central broadly mammillate apex. Margin crenulate/wavy and semi striate.

Odor: fungal with light smell of anise
Taste: mild/none

Photos / Sounds

What

Basidiomycete Fungi (Phylum Basidiomycota)

Observer

aespinosa21

Date

October 22, 2022 09:22 AM HST

Description

ID?

Photos / Sounds

Observer

taraseverns

Date

December 28, 2022 11:02 AM HST

Description

Maunawili Ditch Trail.

Photos / Sounds

What

Purple Fuzz (Punctularia atropurpurascens)

Observer

taraseverns

Date

December 29, 2022 11:13 AM HST

Photos / Sounds

What

Dewdrop Bonnet (Hemimycena tortuosa)

Observer

fmr

Date

March 13, 2015 03:01 PM PDT

Description

Photo 2 - spiral-form caulocystidia

Photos / Sounds

Observer

jackielo77

Date

October 30, 2022 05:03 PM PDT

Photos / Sounds

Observer

adrichandler

Date

October 31, 2020 11:16 AM PDT

Photos / Sounds

What

Insect Destroyers (Order Entomophthorales)

Observer

harsiparker

Date

June 23, 2018 12:25 PM PDT

Description

This observation is for the fungi.

Western Thatching Ant (Formica obscuripes) clinging to grass stem, with unknown entomopathogenic fungi. The two springtails are Entomobrya triangularis and appeared to be eating either the ant, the fungi, or both. Photos of the same ant one day earlier (with abdomen still intact) are here:
https://www.inaturalist.org/observations/99149670

Observation for the ant is here:
https://www.inaturalist.org/observations/99151521

Observation for the springtails is here:
https://www.inaturalist.org/observations/99151881

Photos / Sounds

Observer

brettjackson

Date

October 25, 2021 03:51 PM CDT

Description

Amazing how something so distinctive can be so difficult to identify. On dead Thuja plicata I believe.

Photos / Sounds

Observer

brettjackson

Date

October 25, 2021 04:58 PM CDT

Description

Growing on Corylus cornuta. There seem to be quite a few genera in Sordariomycetes that have orange conidiomata. Allantoporthe decedens is also possible.

Photos / Sounds

What

Contorted Pipe Club (Macrotyphula contorta)

Observer

nudge9

Date

December 16, 2022 02:42 PM PST

Description

Third time I have seen this at work this month! Always on alder!

spores: light or white. images 2,3 are dry but fresh (know that's myco-sinning!!) Image 4 is in water.

Photos / Sounds

Observer

alan_rockefeller

Date

January 27, 2018

Description

Funny plastic like odor. Found by pdvmushroom, see https://www.inaturalist.org/observations/9640562

Photos / Sounds

Observer

damontighe

Date

November 14, 2016 12:30 PM PST

Description

??? There was 3 Amanita in the vicinity of the oak. 1 had traditional A. phalloides coloring

Photos / Sounds

What

Deathcap (Amanita phalloides)

Observer

jwhunt

Date

November 7, 2021 11:39 AM UTC

Photos / Sounds

What

Mushroom Gall Wasp (Heteroecus sanctaeclarae)

Observer

wildmacro

Date

June 22, 2019 03:00 PM PDT

Description

Gall with exit hole on huckleberry oak (Quercus vacciniifolia).

Photos / Sounds

Observer

mgkoons

Date

November 20, 2022 12:50 PM PST

Photos / Sounds

What

Wood Woolly-Foot (Collybiopsis peronata)

Observer

ym_wang_pnw

Date

October 26, 2022 01:32 PM PDT

Photos / Sounds

What

Oak-loving Gymnopus (Gymnopus dryophilus)

Observer

ym_wang_pnw

Date

June 14, 2022 05:09 PM PDT

Description

Seems to turn green in KOH

Photos / Sounds

What

Anther Smuts (Genus Microbotryum)

Observer

betweenthelyons

Date

June 29, 2022 11:27 AM PDT

Description

Smut fungus on anthers of Silene lemmonii. Last photo shows comparison to normal flower

Photos / Sounds

Observer

rachel_swenie

Date

July 30, 2022 02:01 PM EDT

Description

On heavily decayed hardwood log

Photos / Sounds

What

White Maze Polypore (Trametes elegans)

Observer

clm98043

Date

September 16, 2022 03:35 PM PDT

Photos / Sounds

Date

September 18, 2022

Description

🍄

Photos / Sounds

What

Hairy-stalked Collybia (Gymnopus spongiosus)

Observer

jackjohnsonn

Date

July 19, 2022 08:09 PM EDT

Description

Solitary on the ground in litter under mixed hardwood forest of Acer, Quercus, sycamore, Carya, even some Juniper.
Somewhat tough, orange fuzzy base at stipe. No distinct odor. Photos are poor due to thunderstorms.

Photos / Sounds

What

Gunnison's Prairie Dog (Cynomys gunnisoni)

Observer

brian35

Date

September 11, 2022 01:45 PM MDT

Description

White

Photos / Sounds

What

Common Gilled Mushrooms and Allies (Order Agaricales)

Observer

scooby_runner

Date

June 13, 2022 06:39 PM PDT

Photos / Sounds

Observer

royh

Date

August 10, 2022

Description

Pileus cantharelloid in outline, up to 3 cm broad, dry, dull brownish pink. Flesh white, unchanging with bubble gum-like odor. Lamellae decurrent, forked, white to pinkish white, uncahnging. Stipe very short, up to 1 cm long, up to 1 cm broad, tapered downward from apex, dry, pinkish white.

Photos / Sounds

Observer

noah_siegel

Date

October 17, 2020 09:15 AM PDT

Photos / Sounds

What

Waxcaps (Genus Hygrocybe)

Observer

warren_cardimona

Date

July 3, 2022 06:16 PM PDT

Photos / Sounds

What

Chanterelles (Genus Cantharellus)

Observer

jackjohnsonn

Date

July 9, 2022 12:35 PM EDT

Description

Small fruits numbering in the dozens in the sand. No more than 5m long, 1.5cm wide.

Photos / Sounds

Observer

aldendirks

Date

October 17, 2021 10:52 AM EDT

Photos / Sounds

Observer

organicgardner44

Date

October 15, 2013 02:41 PM PDT

Description

Genus confirmed by DNA analysis (Scott Redhead). Unique species on two adjacent small oak stumps

Photos / Sounds

Observer

ertmann

Date

July 26, 2022 05:38 PM PDT

Description

I am an avid mushroom forager, so one of my coworkers brought this specimen into work to ask me what it was that his dog had been digging up in his backyard in South Lake Tahoe.

I brought it home and found that it wasn't in any of my ID books so I posted online on a Facebook group to see if anyone knew what it was.

The following day, while I was at work, I saw that several people thought it was Lactarius rubriviridus, a rare species. I called my girlfriend to tell her, and she told me that our dog had taken it off of the counter and chewed it into pieces.

So, it was both discovered and destroyed by dogs.

My coworker told me that his dog digs them up all the time, but since then he has brought about 10 specimens to me, none of which have been rubriviridus.

I have what is left of the specimen dried in a ziplock bag, but it's a very small amount.

Note: The location on inaturalist is the correct general neighborhood but not precise. The property owner doesn't want the location online. He is continuing to bring me samples, maybe his dog will find another one.

Photos / Sounds

What

Gold Lace Nudibranch (Halgerda terramtuentis)

Observer

craigahoover

Date

June 21, 2017 01:27 AM PDT

Description

Two Halgerda terramtuentis were located on coral reef wall at a depth of approximately 30 feet. Sizes were not measured. Water temperature was 74 degrees F.

Gracias al apoyo de:

¿Quiere apoyarnos? Pregúntenos cómo escribiendo a snib.guatemala@gmail.com