Photos / Sounds

Observer

semilancreator

Date

December 30, 2023 04:00 PM CET

Photos / Sounds

Observer

semilancreator

Date

December 30, 2023 04:10 PM CET

Photos / Sounds

Observer

fern_friend

Date

January 22, 2024 01:40 PM -05

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

kylecanan

Date

December 2023

Place

Ohio, US (Google, OSM)

Description

Psilocybe caeruleorhiza nom. prov.
Description deadline is January 15th 2024.
Found in the same original Ohio location found by Kyle Canan.
The first 4 photos after the cover are my iPhone photos.

Photos / Sounds

Observer

laughingjims

Date

December 3, 2023 02:15 PM PST

Description

Low Tek fruiting method using naturalized woodchip spawn. Fruited in a tote left outside through late November. The culture was collected from a clone from observation https://www.inaturalist.org/observations/96176456

Photos / Sounds

Observer

jonnyvanbatman

Date

October 2023

Place

Portugal (Google, OSM)

Description

Gelatinous removable gill edge. On horse dung.

Photos / Sounds

Observer

david6205

Date

September 19, 2023 04:23 PM MST

Description

Near water on decaying mossy wood among tall grass. Visible blue staining on caps and stems

Photos / Sounds

Observer

alan_rockefeller

Description

About 16 inches long with pseudorhiza

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

angulospora

Date

March 20, 2021 11:08 AM +13

Description

Psilocybe_sp_ITS (502 bp)
CATTATTGAATGAACTTGACTCAGTTGTAGCTGGTCCTCTCGGGGGGCATGTGCTCGCTGTGTCATCTTTATCTATCCACCTGTGCACCTTTTGTAGACTTGGGACTAGTGAACGGGAGAGCTTGCTCTCCTAGAAGCTACACCAGGCCTATGTTTTCATATACCCCAAAGAATGTAACAGAATGTATTGTATGGCCTTGTGCCTATAAATCATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGCCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTCTTTTGCTGGCTTTAGTCGGCTCCCCTCAAATGTATTAGCCGGTSCCCCGCGCAGAGCCGTCTATTGGTGTGATAATT

Photos / Sounds

Observer

hamiltonmorris

Date

July 3, 2016 03:56 PM EDT

Photos / Sounds

Observer

crustysean

Date

July 2023

Place

Missing Location

Description

This was found in the Malaysian rainforest on a pile on elephant dung. I have found many others on other dung piles (Tapir as well) around the rainforest. There was what I think is deconia coprophila on the same pile as this mushroom. Please help me identify this.

Photos / Sounds

Observer

alan_rockefeller

Date

September 7, 2022 04:54 PM CDT

Description

One growing out of a hole, the other is not. The one growing out of the hole had a pseudorhiza, the other did not.

Photos / Sounds

Observer

damontighe

Date

July 2023

Description

HAY-F-005410

microscopy
spores =

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

laughingjims

Date

June 2023

Description

Psilocybe aff. makarora

Photos / Sounds

Observer

tannar_coolhaas

Date

April 2019

Photos / Sounds

Observer

juancarlosmejia

Date

April 2023

Place

Colombia (Google, OSM)

Photos / Sounds

What

Common Gilled Mushrooms and Allies (Order Agaricales)

Observer

cinclosoma

Date

July 2023

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

oksanababiich

Date

July 23, 2023 05:50 PM EEST

Description

на кінських екскрементах.

Photos / Sounds

Observer

phillbobaggins

Date

August 9, 2021 04:37 PM HST

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

david_taylor

Date

January 17, 2022 04:17 PM SAST

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

david_taylor

Date

March 9, 2022 05:07 PM SAST

Photos / Sounds

Observer

carlyd95

Date

April 7, 2022 09:54 AM EDT

Description

Seen beginning to fruit after several consecutive rainy days

Photos / Sounds

Observer

mikepotts

Date

August 2021

Place

Oregon, US (Google, OSM)

Description

First recorded INaturalist observation in Oregon at Crater Lake National Park!

Photos / Sounds

Observer

alan_rockefeller

Date

July 5, 2021 05:36 PM PDT

Photos / Sounds

What

Liberty Cap (Psilocybe semilanceata)

Observer

nschwab

Date

September 30, 2019 10:04 PM CEST

Description

Collector: Charles-Henri Pochon

Photos / Sounds

Observer

nschwab

Date

October 10, 2022 11:59 AM CEST

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

nschwab

Date

September 9, 2018 03:49 PM CEST

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

iskibear

Date

July 13, 2023 11:36 AM PDT

Description

Alan this is all I’ve seen this season. It’s going to be scorching hot starting tomorrow. Let me know if I can help with anything. Cheers, Tia

Photos / Sounds

What

Banded Mottlegill (Panaeolus cinctulus)

Observer

eric830

Date

July 1, 2023 03:56 PM EDT

Description

Maybe bisporus also

Photos / Sounds

Observer

lennyworthington

Date

August 21, 2012 04:10 PM +07

Description

Psilocybe magnispora
E. Horak, Guzmán & Desjardin (145914)

On Elephant dung

Photos / Sounds

Observer

natujuano

Date

March 12, 2020

Photos / Sounds

Observer

nelsonmv

Date

June 25, 2023 09:58 AM CST

Photos / Sounds

Date

May 27, 2023 03:17 PM -04

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

laughingjims

Date

June 2023

Description

Both cap and stem fluoresce a dull blue

Photos / Sounds

Observer

scottostuni

Date

June 2023

Place

Private

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

laughingjims

Date

June 2023

Description

Psilocybe aff. makarora
Stem and cap fluoresce yellow under 365nm UV light

Photos / Sounds

Observer

mycelle

Date

June 24, 2023 01:15 PM NZST

Photos / Sounds

Observer

scottostuni

Date

June 24, 2023 10:24 AM EDT

Photos / Sounds

What

Magic Mushroom (Psilocybe cubensis)

Observer

hornyfungi

Date

May 20, 2023 11:39 PM EDT

Photos / Sounds

Observer

mstirling

Date

June 2023

Place

Private

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

angulospora

Date

April 1, 2022 12:21 PM NZDT

Place

Rotorua (Google, OSM)

Description

Psilocybe 'subsecotioides'

Photos / Sounds

Observer

malacothrix

Date

August 2022

Description

Growing near a stream in a spruce and pine forest. Fruitbodies were found in the grass next to the stream and on rotting wood nearby.

Spores ~ 12-14 x 6-8um

All microscopy at 1000x in KOH with scale bar showing 1um per tic

Photos / Sounds

What

Banded Mottlegill (Panaeolus cinctulus)

Observer

scottostuni

Date

June 27, 2022 01:04 PM MDT

Photos / Sounds

Observer

alan_rockefeller

Date

November 14, 1980

Description

Collected Nov. 14, 1977. P. Stamets 77-26

Photos / Sounds

Observer

juancarlosmejia

Date

April 2023

Place

Colombia (Google, OSM)

Photos / Sounds

Observer

alan_rockefeller

Date

May 23, 2000

Description

Isotype collection.

Found on a soil bank. Seen at XAL.

Stained with Phloxine.

Photos / Sounds

Observer

alan_rockefeller

Date

February 15, 2020

Description

Found right next to a waterfall.

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

jordanjacobs

Date

May 2023

Description

'makarorae aff' aka 'jelly subs' fruiting in someones garden.

Photos / Sounds

Observer

holymushroom

Date

June 2023

Photos / Sounds

What

Psychedelic Ovoid Mushroom (Psilocybe ovoideocystidiata)

Observer

danivaill

Date

October 2020

Photos / Sounds

Observer

holymushroom

Date

June 28, 2022 09:02 PM CDT

Description

Sneaky sillokis...too close to heimii but so far. Phaeocollybia sp due to spore print bright orange.

Photos / Sounds

Observer

jordanjacobs

Date

June 10, 2023 07:21 PM NZST

Description

Locals note that this phenotype opens more than many other collections of weraroa, suggesting a phenotype between weraroa and 'subsecotioides'.

Photos / Sounds

Observer

hendre17

Date

November 30, 2013

Description

Fruiting in alder mulch and debris- beneath Douglas fir and Alnus rubra.

Some older specimens staining blue-green at stipe base. Hundreds of fruit bodies within a ten foot radius.

Temp: 49-clear.

Photos / Sounds

Observer

inoculatethewest

Date

October 17, 2020 09:04 AM PDT

Description

Psilocybe Cyanofibrillosa growing from woodchips in an elementary school playground.

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

alan_rockefeller

Date

December 2, 2008

Description

Ganymede collection.

Spores are 9.25 – 10.5 (10.75) x 4.5 – 5.5. (Alan’s measurements)

Or (8.83) 9.80-10.3-10.64 (12.17) x (4.55) 5.02-5.2-5.53 (5.89) (Jan’s measurements).

DNA sequence shows it’s close to P. pelliculosa.

Photos / Sounds

Observer

christina825

Date

November 20, 2020 12:49 PM UTC

Photos / Sounds

What

Wavy Cap (Psilocybe cyanescens)

Observer

ovoidmusic

Date

May 2022

Description

Rare may cyanescens after a particularly cold spring.

Photos / Sounds

What

Cortinarius Sect. Walkeri (Section Walkeri)

Observer

alan_rockefeller

Date

June 8, 2023 03:13 PM NZST

Description

Under Nothofagus

Photos / Sounds

Observer

laughingjims

Date

June 2023

Description

Psilocybe cf. tasmaniana

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

morpheous

Date

May 2021

Description

In container plant. Could be tasmaniana?

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

sfinat

Date

May 22, 2021 10:08 AM NZST

Description

Possibly Stunzii

Photos / Sounds

Observer

tannar_coolhaas

Date

May 28, 2019 12:37 PM AEST

Photos / Sounds

Observer

alan_rockefeller

Date

November 24, 1980

Description

Collected November 24, 1966 by T. Hongo. Collection T. Hongo 3385.

Found in grass at the edge of a bamboo forest.

Photos / Sounds

Observer

epicureanjinu

Date

December 15, 2022 09:21 AM IST

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

colindomnauer

Date

June 2023

Photos / Sounds

Observer

joeysantore

Date

June 2023

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

ormiz456

Date

February 11, 2023 03:22 PM +07

Description

Found in a potted plant at a gardening shop

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

cygnet

Date

June 1, 2023 02:15 PM AEST

Photos / Sounds

What

Psilocybe Sect. Cordisporae (Section Cordisporae)

Observer

suse100

Date

June 2, 2016

Description

Originally posted to Mushroom Observer on Nov. 25, 2016.

Photos / Sounds

What

Drunken Mushroom (Psilocybe zapotecorum)

Observer

suse100

Date

January 6, 2016

Description

Originally posted to Mushroom Observer on Mar. 4, 2016.

Photos / Sounds

Observer

alan_rockefeller

Date

September 27, 2005

Description

Isotype collection.

Photos / Sounds

What

Mel-29 (Morchella magnispora)

Observer

alan_rockefeller

Date

May 26, 2023 04:41 PM PDT

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

suse100

Date

October 26, 2014

Description

Originally posted to Mushroom Observer on Nov. 14, 2014.

Photos / Sounds

What

Drunken Mushroom (Psilocybe zapotecorum)

Observer

suse100

Date

October 26, 2014

Description

Originally posted to Mushroom Observer on Nov. 16, 2014.

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

alan_rockefeller

Date

May 2023

Description

In wood chip landscaping. Taste strongly farinaceous, with no hint of radish or other flavors.

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

suse100

Date

January 9, 2015

Description

Originally posted to Mushroom Observer on Feb. 27, 2015.

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

juancarlosmejia

Date

April 2023

Place

Colombia (Google, OSM)

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

garyheslin

Date

May 14, 2023 10:48 AM AEST

Photos / Sounds

Observer

bruno447

Date

December 2020

Description

Stains super blue (see 3rd picture).
I can't really see the "flying saucer" pattern on the bigger ones, but it could have been deformed by the environment.

Photos / Sounds

Observer

peterzuidland

Date

April 16, 2021 08:47 AM AEST

Photos / Sounds

Observer

tannar_coolhaas

Date

April 23, 2019 09:51 AM AEST

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

mycelle

Date

May 12, 2023 12:53 PM NZST

Description

15cm tall, big wavy edged caps, blueing, singular or with stems fused at the base. In wood chip and soil.

https://inaturalist.nz/observations/87154556 (seq) April 23rd 2021

https://inaturalist.nz/observations/167069008 June 11th
https://inaturalist.nz/observations/168270398 June 10th
https://inaturalist.nz/observations/166561227 June 10th
https://inaturalist.nz/observations/158512396 April 23rd 2023

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

sam_willis

Date

October 2022

Place

Private

Photos / Sounds

Observer

kallampero

Date

October 29, 2011

Description

400x KOH – gill edge

Photos / Sounds

Observer

jamison_gauci

Date

October 26, 2022 11:20 AM EDT

Description

Growing in aged local woodchip bed. Small groups spread out ove at least a 2500ft2 area

Photos / Sounds

Observer

alan_rockefeller

Date

October 30, 2020

Description

Growing in a mulched garden.

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

angulospora

Date

May 9, 2023 11:49 AM NZST

Place

Whangārei (Google, OSM)

Description

Found during cyclone so was hard to take photos, needs sequencing but suspect something close to Psilocybe baeocystis.

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

angulospora

Date

May 14, 2023 10:24 PM NZST

Place

Hamilton (Google, OSM)

Description

Psilocybe 'subsecotioides'

Photos / Sounds

What

Niveos (Psilocybe niveotropicalis)

Observer

scottostuni

Date

May 11, 2023 09:51 AM EDT

Photos / Sounds

Date

November 2020

Place

Missing Location

Description

spore purple black, in groups, on cow dung

Photos / Sounds

Observer

scottostuni

Date

May 29, 2022 07:24 PM IST

Description

Spores:
measuring 7.78 – 10.15 × 5.44 – 6.69 µm
Q = 1.26 – 1.64 ; N = 30
Me = 8.57 × 6.16 µm ; Qe = 1.38

9.00 × 6.35
8.45 × 6.13
8.91 × 6.31
8.71 × 6.50
8.31 × 5.71
9.11 × 6.62
9.01 × 6.60
8.71 × 6.17
8.11 × 6.08
8.25 × 6.12
10.15 × 6.18
8.82 × 6.61
8.78 × 6.05
7.89 × 5.52
8.40 × 6.48
8.20 × 6.05
8.36 × 6.25
8.09 × 5.68
8.43 × 6.03
8.16 × 6.23
8.50 × 6.30
8.61 × 6.35
8.41 × 6.48
8.24 × 5.72
8.63 × 6.28
8.57 × 6.34
8.97 × 6.69
8.56 × 5.92
8.20 × 5.44
7.78 × 6.19

Photos / Sounds

Date

May 8, 2023 11:00 AM -04

Place

Valdivia (Google, OSM)

Description

Crece en pradera, no directamente en estiércol

Photos / Sounds

What

Psychedelic Ovoid Mushroom (Psilocybe ovoideocystidiata)

Observer

alan_rockefeller

Date

January 10, 2006

Description

Auweia collection.

[admin – Sat Aug 14 02:05:14 +0000 2010]: Changed location name from ‘Richmond, CA, USA’ to ‘Richmond, California, USA’

Image #4: Microscopy composite by Workman

Originally posted to Mushroom Observer on Feb. 19, 2009.

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

alan_rockefeller

Date

November 17, 2021

Description

James R. collection.

Additional notes for sequences (bases on the right):

ITS:

Originally posted to Mushroom Observer on Mar. 9, 2022.

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

foreverfungi

Date

May 2023

Description

Growing from soil in a paddock frequented by horses.

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

ivan862

Date

February 10, 2023 07:07 PM -05

Photos / Sounds

Observer

lizziepop

Date

February 6, 2021 01:38 PM SAST

Photos / Sounds

Observer

andrewkilian

Date

March 25, 2023 02:55 PM SAST

Place

George (Google, OSM)

Photos / Sounds

What

Psychedelic Ovoid Mushroom (Psilocybe ovoideocystidiata)

Observer

pipsissewa

Date

April 2023

Description

Found by my daughter. No blue bruising notice immediately, however upon zooming in on photos you can see some slight blue bruising at the stem Apex and on some of the Gil margins. Later as the mushroom dried, more intense bluing present in the gills at the stem connection and at the stem Apex. Found in a woodpile that appeared to be bulldozzed. Identification confirmed by Kenneth barbagallo

Gracias al apoyo de:

¿Quiere apoyarnos? Pregúntenos cómo escribiendo a snib.guatemala@gmail.com