Photos / Sounds

What

Elongate Hemlock Scale (Fiorinia externa)

Observer

herebespiders11

Date

February 23, 2024 04:01 PM EST
Elongate Hemlock Scale - Photo (c) Johnny Wilson, all rights reserved, uploaded by Johnny Wilson
daviswj's ID: Elongate Hemlock Scale (Fiorinia externa)
Added on February 24, 2024
Supporting

Photos / Sounds

Observer

valve

Date

February 21, 2024 04:24 PM AEDT
Mallomonas - Photo (c) Karolina Fucikova, some rights reserved (CC BY-NC), uploaded by Karolina Fucikova
daviswj's ID: Genus Mallomonas, a member of Synurids (Class Synurophyceae)
Added on February 23, 2024
Supporting

Photos / Sounds

Observer

valve

Date

February 21, 2024 03:57 PM AEDT
Mallomonas - Photo (c) Karolina Fucikova, some rights reserved (CC BY-NC), uploaded by Karolina Fucikova
daviswj's ID: Genus Mallomonas, a member of Synurids (Class Synurophyceae)
Added on February 23, 2024
Supporting

Photos / Sounds

Observer

valve

Date

February 21, 2024 04:24 PM AEDT
Mallomonas - Photo (c) Karolina Fucikova, some rights reserved (CC BY-NC), uploaded by Karolina Fucikova
daviswj's ID: Genus Mallomonas, a member of Synurids (Class Synurophyceae)
Added on February 23, 2024
Supporting

Photos / Sounds

What

Elongate Hemlock Scale (Fiorinia externa)

Observer

herebespiders11

Date

February 20, 2024 01:23 PM EST

Description

Also hemlock woolly adelgid

Elongate Hemlock Scale - Photo (c) Johnny Wilson, all rights reserved, uploaded by Johnny Wilson
daviswj's ID: Elongate Hemlock Scale (Fiorinia externa)
Added on February 20, 2024
Supporting

Photos / Sounds

What

Hemlock Woolly Adelgid (Adelges tsugae)

Observer

herebespiders11

Date

February 20, 2024 01:23 PM EST

Description

Also elongate hemlock scale

Hemlock Woolly Adelgid - Photo (c) BlueRidgeKitties, some rights reserved (CC BY-NC-SA)
daviswj's ID: Hemlock Woolly Adelgid (Adelges tsugae)
Added on February 20, 2024
Supporting

Photos / Sounds

What

Penicillium (Genus Penicillium)

Observer

imasongster

Date

February 18, 2024 04:31 PM EST
Penicillium - Photo (c) Keith Seifert, some rights reserved (CC BY-SA), uploaded by Keith Seifert
daviswj's ID: Penicillium (Genus Penicillium)
Added on February 19, 2024
Supporting

Photos / Sounds

Observer

s_k_johnsgard

Date

February 12, 2024 11:22 AM CST

Description

I believe this is fungal in origin with spore capsules at the termini. The strands are about 2 inches (5 cm) in length. Growing from (possibly) bird droppings in an outdoor flower pot.

Phycomyces - Photo (c) brngckn, all rights reserved, uploaded by brngckn
daviswj's ID: Genus Phycomyces, a member of Pin Molds (Order Mucorales)
Added on February 14, 2024
Supporting

Photos / Sounds

What

Pin Molds (Order Mucorales)

Observer

yanshuotinzgo

Date

February 11, 2024 11:53 AM CST
Pin Molds - Photo (c) mushrooooms, some rights reserved (CC BY-NC), uploaded by mushrooooms
daviswj's ID: Pin Molds (Order Mucorales)
Added on February 11, 2024
Leading

Photos / Sounds

What

Higher Basidiomycetes (Subphylum Agaricomycotina)

Observer

joncbales

Date

April 12, 2016 11:29 AM CDT

Place

Missing Location

Description

Green circles in grass at airport 02c

Higher Basidiomycetes - Photo (c) Meg Madden, some rights reserved (CC BY-NC), uploaded by Meg Madden
daviswj's ID: Higher Basidiomycetes (Subphylum Agaricomycotina)
Added on February 8, 2024
Leading

Photos / Sounds

What

Pin Molds (Order Mucorales)

Observer

huttonia

Date

February 2024

Place

Ohio, US (Google, OSM)

Description

???

Pin Molds - Photo (c) mushrooooms, some rights reserved (CC BY-NC), uploaded by mushrooooms
daviswj's ID: Pin Molds (Order Mucorales)
Added on February 2, 2024
Improving

Photos / Sounds

Date

March 24, 2023 11:03 AM CET

Description

Inside a cave.

Phycomyces - Photo (c) brngckn, all rights reserved, uploaded by brngckn
daviswj's ID: Genus Phycomyces, a member of Pin Molds (Order Mucorales)
Added on February 2, 2024
Supporting

Photos / Sounds

What

Rust Fungi (Order Pucciniales)

Observer

christineyoung

Date

August 21, 2022 09:06 AM EDT

Description

Puccinia cnici-oleracei?

Rust Fungi - Photo (c) Tim N, some rights reserved (CC BY-NC), uploaded by Tim N
daviswj's ID: Rust Fungi (Order Pucciniales)
Added on January 30, 2024
Supporting

Photos / Sounds

Observer

christineyoung

Date

August 21, 2022 08:50 AM EDT

Description

Host: Vernonia (Ironweed)

Rust Fungi - Photo (c) Tim N, some rights reserved (CC BY-NC), uploaded by Tim N
daviswj's ID: Rust Fungi (Order Pucciniales)
Added on January 30, 2024
Improving

Photos / Sounds

Observer

grinnin

Date

January 2024

Description

Of the various kinds of organisms that cause plant disease, plant-parasitic algae are not the norm: the only species common in the USA is this one, a plant pathogen infecting tea, coffee, and coconut plants, causing algal or rust algal leaf spot (a.k.a green scurf) on over 200 plant species (more than 60 families) from NC to FL and into TX, most commonly plants with somewhat leathery leaves, like this magnolia, or camellia & holly

Older algal colonies that become colonized (lichenized) by a fungus turn into leaf spot lichens, composite organisms of an alga and a fungus, then classified in the genus Strigula, the only lichen parasitic on plants, most visible on leaves, but also twigs & branches, even fruit, the crusty gray-green to greenish-brown color circular/blotchy spots generally somewhat raised from the plant surface, the edges often wavy or feathered; however, in summer, when the alga reproduces, the spots turn a velvety red-brown due to the production of reddish, spore-producing structures... numerous colonies can cause premature yellowing and loss of leaves

Cephaleuros virescens - Photo (c) 大肚魚, some rights reserved (CC BY-NC), uploaded by 大肚魚
daviswj's ID: Cephaleuros virescens, a member of Orange Terrestrial Algae (Family Trentepohliaceae)
Added on January 30, 2024
Supporting

Photos / Sounds

Observer

markuskrieger

Date

January 28, 2024 01:40 PM CET

Description

They have multiplied significantly in the sample over the last 2 days.

Haematococcus - Photo (c) Erin Moise, some rights reserved (CC BY-NC), uploaded by Erin Moise
daviswj's ID: Genus Haematococcus, a member of Chlorophycean Green Algae (Class Chlorophyceae)
Added on January 30, 2024
Supporting

Photos / Sounds

What

Higher Ascomycetes (Subphylum Pezizomycotina)

Observer

threegee

Date

May 27, 2023 01:09 PM CST
Ascomycete Fungi - Photo (c) Christian Schwarz, some rights reserved (CC BY-NC), uploaded by Christian Schwarz
daviswj's ID: Ascomycete Fungi (Phylum Ascomycota)
Added on January 25, 2024
Improving

Photos / Sounds

What

Insect Destroyers (Order Entomophthorales)

Observer

matt2107

Date

July 22, 2016
Insect Destroyers - Photo (c) tjeales, some rights reserved (CC BY-SA), uploaded by tjeales
daviswj's ID: Insect Destroyers (Order Entomophthorales)
Added on January 15, 2024
Improving

Photos / Sounds

Observer

jueming641

Date

March 18, 2023 01:03 AM CST
Rhizopus - Photo (c) Comrade Foot, some rights reserved (CC BY-SA)
daviswj's ID: Genus Rhizopus, a member of Pin Molds (Order Mucorales)
Added on January 15, 2024
Leading

Photos / Sounds

What

Pythium Turf Blight (Pythium aphanidermatum)

Observer

wallacechen

Date

August 11, 2003
Pythium - Photo (c) 大肚魚, some rights reserved (CC BY-NC), uploaded by 大肚魚
daviswj's ID: Genus Pythium, a member of Water Molds (Phylum Oomycota)
Added on January 14, 2024
Improving

Photos / Sounds

Observer

bruce_suillus

Date

November 8, 2021 04:18 PM UTC

Description

Isolated from soil collected in a walnut grove. Oomycetes were baited by soaking soil in sterilized pond water with radish seed and other baits. Radish seed was placed in a hole cut in plate of water agar, and the hyphae that emerged were transferred to cornmeal agar.

ITS sequence:
GAGATTTTCGTGCGTGTTTGTGGTATCGCTATGTATTCGTACGTGGCGTTAGCAAGCATTGTATGGAGCTTGGCTGATCGAAGGTCGGTGCACACCTTGTGTGTGTGTTGGCTGATTAACCTTTCAAACCCTTTCAATAAATACTGATTATACTGTGAGGACGAAAGTCTTTGCTTTTATCTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATACCTGGAAGTATGTCTGTATCAGTGTCCGTACATCAAACTTGCCTCTTTTTGTCGGTGTAGTCCGATCGAGAGTATGGCAGACGTGAGGTGTCTCGCGACTCGTATATCATTGTGTGTGTAAATCGTAAGAGATACATACAGAAGGTAGTATATAACTTGTTGCGAGTCCCTTTAAAACGACACGATCTTTCTATTTGCTTTCTATGGAGCGTGTATTTCGAACGCGGTGGTCCTCGGATCGCTTGCAGTCGGCAGCGACTTCAGTGAAGACATAGTGAAGAAACCTCTATTCGCGGTACGTTAGGCTTCGGCTCGACAATGTTGCGTTCTAGTGTGTGGACTCCGTTTTCGCTTTGAGGTGTACTGTTCGGTTGTGGGTTTGAGCCTTGGTATTGCTTTGTTAGTAGAGATATCTCGATTTTCTGTAGTTTGATTCTGCATACACGCAAGTGTGTGTGGGTAGAGAGTATCTATTTGGGAAATTTTGTACTGCGTGCGCTTTCGAGTGTGTGTATGTATCTCAATTGGACCTGATATCAGACAAGACTACCCGCTGAACTTAA

BLAST hits with >99% ID to Pythium sp., P. longandrum, and P. urmium.

Pythium - Photo (c) 大肚魚, some rights reserved (CC BY-NC), uploaded by 大肚魚
daviswj's ID: Genus Pythium, a member of Water Molds (Phylum Oomycota)
Added on January 14, 2024
Supporting

Photos / Sounds

What

Pin Molds (Order Mucorales)

Observer

smalltown_huang

Date

August 27, 2022 07:25 PM CST
Pin Molds - Photo (c) mushrooooms, some rights reserved (CC BY-NC), uploaded by mushrooooms
daviswj's ID: Pin Molds (Order Mucorales)
Added on January 10, 2024
Leading

Photos / Sounds

What

Water Fern (Azolla filiculoides)

Observer

garrett_r

Date

November 3, 2023 10:33 AM PDT
Water Fern Family - Photo (c) Sergey Mayorov, some rights reserved (CC BY-NC), uploaded by Sergey Mayorov
daviswj's ID: Water Fern Family (Family Salviniaceae)
Added on January 7, 2024
Supporting

Photos / Sounds

What

Water Fern (Azolla filiculoides)

Observer

garrett_r

Date

November 3, 2023 10:33 AM PDT
Mosquito Ferns - Photo (c) 王美芳, some rights reserved (CC BY-NC), uploaded by 王美芳
daviswj's ID: Mosquito Ferns (Genus Azolla)
Added on January 7, 2024
Improving

Photos / Sounds

Observer

jane_trembath

Date

April 19, 2023 02:20 PM SAST
Actinosphaerium - Photo (c) Proyecto Agua, some rights reserved (CC BY-NC-SA)
daviswj's ID: Genus Actinosphaerium, a member of Kelp, Diatoms, and Allies (Kingdom Chromista)
Added on January 4, 2024
Supporting

Photos / Sounds

Observer

jane_trembath

Date

April 14, 2023 05:36 PM SAST
Actinophrys - Photo (c) ja:User:NEON, some rights reserved (CC BY-SA)
daviswj's ID: Genus Actinophrys, a member of Kelp, Diatoms, and Allies (Kingdom Chromista)
Added on January 4, 2024
Supporting

Photos / Sounds

Observer

jane_trembath

Date

April 19, 2023 06:10 PM SAST
Staurastrum - Photo (c) jnienow, some rights reserved (CC BY-NC)
daviswj's ID: Genus Staurastrum, a member of Desmid (Order Zygnematales)
Added on January 4, 2024
Supporting

Photos / Sounds

Observer

jane_trembath

Date

December 24, 2023 02:43 PM SAST
Desmodesmus - Photo (c) Karolina Fucikova, some rights reserved (CC BY-NC), uploaded by Karolina Fucikova
daviswj's ID: Genus Desmodesmus, a member of Chlorophycean Green Algae (Class Chlorophyceae)
Added on January 4, 2024
Supporting

Photos / Sounds

Observer

mlankford

Date

January 1, 2024 12:57 PM EST

Description

Fresh water pond

Closterium - Photo (c) Antonio Guillén, some rights reserved (CC BY-NC-SA)
daviswj's ID: Genus Closterium, a member of Desmid (Order Zygnematales)
Added on January 4, 2024
Supporting

Photos / Sounds

Observer

mlankford

Date

January 1, 2024 03:16 PM EST

Description

Fresh water pond

Trachelomonas - Photo (c) Karolina Fucikova, some rights reserved (CC BY-NC), uploaded by Karolina Fucikova
daviswj's ID: Genus Trachelomonas, a member of Euglenids (Class Euglenida)
Added on January 4, 2024
Supporting

Stats

  • 4837

Gracias al apoyo de:

¿Quiere apoyarnos? Pregúntenos cómo escribiendo a snib.guatemala@gmail.com