Stunning and rare specimen, growing solitary in sandy soil, grass and moss, southeast Michigan. Base of stipe bruised blue immediately when plucked from the ground. Pholiotina/Conocybe smithii? Or is this perhaps Pholiotina/Conocybe cyanopus? Found more of what I believe to be the same species nearby, however they were less mature mushrooms and appear as if they may be a different species (later group pictures removed).
On Quercus agrifolia
Possibly Psilocybe orinii nom. prov
or P. tasmaniana
found in a potted plant
Wavy caps? Mushrooms? I’m not sure what these are I’m probably wrong
found on new years, around 40°F, 5°C, waterlogged from rain, lighter caps were dryer/ underneath tree branches, huge patch on very old mulch, clusters of 2-3, caps seem to go convex when older, younger ones mostly flat or slightly concave
growing in moss, next to a bog
stem turning darker after manipulation
5 different fish, all with distinct throat slashes. This particular stream contains only coastal cutthroats.
Photos by JimmytheWorm.
[admin – Sat Aug 14 01:58:18 +0000 2010]: Changed location name from ‘BC, Canada’ to ‘British Columbia, Canada’
Found in native bush.
growing near white pine, recently cleared area, light brown spore print, blue bruising where damaged. On the border of the Northeastern sands and Northern Lake Michigan Coastal ecological landscapes. Growing alongside Panaeolus foenisecii, Panaeolus cinctulus, Aleuria aurantia. and Conocybe tenera.
Macroscopic photos by knarkkorven. Micrographs by Alan Rockefeller.
From this thread.
Scale divisions 10.00 micrometers.
Spores (7.5) 7.7 – 8.9 (10.3) x (4.3) 4.4 – 4.8 (4.9) μm.
7.53 × 4.52
7.76 × 4.37
8.09 × 4.32
8.18 × 4.51
8.23 × 4.52
8.31 × 4.32
8.37 × 4.41
8.37 × 4.41
8.37 × 4.51
8.41 × 4.79
8.51 × 4.51
8.51 × 4.60
8.55 × 4.83
8.69 × 4.65
8.74 × 4.41
8.93 × 4.88
10.37 × 5.25
ITS1 sequence:
TATTGATATGCTTAAGTTCAGCGGGTAATCCTACCTGATTTGAGGTCAAAATGATCATTAAGTTGGTTGGCAGGGCCAAC
GGTTAGAAGCAGAGTCCCACTCAAAGGCTGTCGTCTGCATAGCGTAGATAATTATCACACTAACAGATGGACTGCAGGGG
TTACACTCCAGCTAATGCATTTGAGGAGAGCAGACTGTGAGGCCCGCAAAGACTCCCAATTCCAAGCCGCTCTCTACACA
AAAATGTAAGAGTGGTTGATAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTC
AAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCA
AGAGATCCGTTGCTGAAAGTTGTATAGATTTTATAGGCTGTTTTAAGGCCTTCTAAACGTTCTGATACATTCTTTTGGGG
TATATTGTAATAACGTAGACCCTCTGGACGTTGCTCACAGGAAAGCCGACAGCAGTGAAGCTGCGCAGCAAACCTCAACT
CCGAGCCCAAAAGCTCGATAACCAGAATACGGGTCTACAGAAGGTGCACAGGTGGAAAAGTAAAAATGACAGACGTGCAC
AGTACTCCCTGAGGAGCCAGCAACAGTCCACCAAGTTTATTCATTAATGATCCTCCGCA