Photos / Sounds

What

Fiber Caps (Genus Inocybe)

Observer

kathleendobson

Date

April 11, 2024 10:00 PM PDT

Description

Growing in duff
cap 3.5 cm
Elevation: 84 m

Spores light brown

Tags

Fiber Caps - Photo (c) noah_siegel, some rights reserved (CC BY-NC-SA), uploaded by noah_siegel
sulcatus's ID: Fiber Caps (Genus Inocybe)
Added on April 13, 2024
Improving

Photos / Sounds

What

Cortinarius Subg. Telamonia (Subgenus Telamonia)

Observer

maddieframe

Date

April 12, 2024 12:00 PM PDT
Cortinarius Sect. Verni - Photo (c) noah_siegel, some rights reserved (CC BY-NC-SA), uploaded by noah_siegel
sulcatus's ID: Cortinarius Sect. Verni (Section Verni)
Added on April 13, 2024
Leading

Photos / Sounds

Observer

johnplischke

Date

August 11, 2023 07:00 PM EDT

Description

03961 WF23-0181
Thaxterogaster corrugis
DNA - ITS - Nanopore
match to type
DNA looks wrong

Mallocybe - Photo (c) Christian Schwarz, some rights reserved (CC BY-NC), uploaded by Christian Schwarz
sulcatus's ID: Genus Mallocybe, a member of Fibercaps and Allies (Family Inocybaceae)
Added on April 6, 2024
Maverick

Photos / Sounds

Observer

johnplischke

Date

September 4, 2023 08:23 PM EDT
Wrinkled Cortinarius - Photo (c) Jason Hollinger, some rights reserved (CC BY)
sulcatus's ID: Wrinkled Cortinarius (Cortinarius corrugatus)
Added on April 6, 2024
Leading

Photos / Sounds

What

Cortinarius Subg. Telamonia (Subgenus Telamonia)

Observer

jordan_gates_

Date

October 15, 2023 03:10 PM PDT

Description

Willow

Cortinarius Subg. Telamonia - Photo (c) mycowalt, some rights reserved (CC BY-SA), uploaded by mycowalt
sulcatus's ID: Cortinarius Subg. Telamonia (Subgenus Telamonia)
Added on April 6, 2024
Supporting

Photos / Sounds

Observer

fredojusto

Date

November 2, 2022 11:36 AM ADT
Cortinarius atroalbus - Photo (c) Shannon Adams, all rights reserved, uploaded by Shannon Adams
sulcatus's ID: Cortinarius atroalbus, a member of Cortinarius Sect. Atroalbi (Section Atroalbi)
Added on March 31, 2024
Supporting

Photos / Sounds

What

Phlegmy Webcaps (Genus Phlegmacium)

Observer

kendrasvea

Date

November 18, 2023 03:44 PM PST

Description

Appeared olive toned in the field.

Cortinarius ochrophyllus - Photo (c) Marco Floriani, some rights reserved (CC BY-NC), uploaded by Marco Floriani
sulcatus's ID: Cortinarius ochrophyllus, a member of Cortinarius Sect. Laeti (Section Laeti)
Added on March 29, 2024
Maverick

Photos / Sounds

Observer

kendrasvea

Date

January 14, 2023 11:20 AM PST

Description

Boggy area

Cortinarius rigens - Photo (c) Nicolas Schwab, some rights reserved (CC BY-NC), uploaded by Nicolas Schwab
sulcatus's ID: Cortinarius rigens, a member of Cortinarius Sect. Obtusi (Section Obtusi)
Added on March 25, 2024
Supporting

Photos / Sounds

Observer

dannymi

Date

October 13, 2018 02:53 PM PDT
Phlegmacium variosimile - Photo (c) pinonbistro, some rights reserved (CC BY-SA), uploaded by pinonbistro
sulcatus's ID: Phlegmacium variosimile, a member of Phlegmy Webcaps (Genus Phlegmacium)
Added on March 24, 2024
Leading

Photos / Sounds

Observer

fredojusto

Date

October 20, 2022 01:14 PM ADT
Cortinarius dolabratus - Photo (c) Stephen Russell, some rights reserved (CC BY-NC), uploaded by Stephen Russell
sulcatus's ID: Cortinarius dolabratus, a member of Cortinarius Sect. Tortuosi (Section Tortuosi)
Added on March 19, 2024
Supporting

Photos / Sounds

What

Wrinkled Cortinarius (Cortinarius caperatus)

Observer

pipergeorge

Date

August 29, 2021 08:30 PM PDT
Webcaps - Photo (c) Bruce Newhouse, some rights reserved (CC BY-NC-ND), uploaded by Bruce Newhouse
sulcatus's ID: Webcaps (Genus Cortinarius)
Added on March 16, 2024
Supporting

Photos / Sounds

What

Common Gilled Mushrooms and Allies (Order Agaricales)

Observer

northernskye

Date

August 2, 2016 12:44 PM UTC
Orange Webcap - Photo (c) kmohatt, all rights reserved, uploaded by kmohatt
sulcatus's ID: Orange Webcap (Cortinarius mucosus)
Added on March 16, 2024
Leading

Photos / Sounds

Observer

isaac_aguilar

Date

July 10, 2022 04:06 PM AKDT
Nolanea - Photo (c) Damon Tighe, some rights reserved (CC BY-NC), uploaded by Damon Tighe
sulcatus's ID: Subgenus Nolanea, a member of Pinkgills (Genus Entoloma)
Added on March 16, 2024
Supporting

Photos / Sounds

What

Webcaps (Genus Cortinarius)

Observer

mcvaz

Date

August 11, 2022 12:42 PM AKDT
Webcaps - Photo (c) Bruce Newhouse, some rights reserved (CC BY-NC-ND), uploaded by Bruce Newhouse
sulcatus's ID: Webcaps (Genus Cortinarius)
Added on March 16, 2024
Leading

Photos / Sounds

What

Milkcaps, Brittlegills and Allies (Family Russulaceae)

Observer

carsun

Date

September 12, 2023 05:23 PM AKDT

Place

AK, US (Google, OSM)

Description

Vet ej exakt vilken art.

Milkcaps, Brittlegills and Allies - Photo (c) zetapass, all rights reserved
sulcatus's ID: Milkcaps, Brittlegills and Allies (Family Russulaceae)
Added on March 16, 2024
Supporting

Photos / Sounds

What

Shara (Genus Lactarius)

Observer

carsun

Date

September 12, 2023 01:28 PM AKDT

Place

AK, US (Google, OSM)

Description

Alaska, såg ut som en riska men ingen mjölk och fylligt ben

Common Milkcaps - Photo (c) Damon Tighe, some rights reserved (CC BY-NC), uploaded by Damon Tighe
sulcatus's ID: Shara (Genus Lactarius)
Added on March 16, 2024
Leading

Photos / Sounds

What

King Bolete (Boletus edulis)

Observer

slsfish

Date

July 30, 2023 01:11 PM AKDT
King Bolete - Photo (c) MK-fotky, some rights reserved (CC BY-NC-ND)
sulcatus's ID: King Bolete (Boletus edulis)
Added on March 16, 2024
Supporting

Photos / Sounds

What

Cortinarius Subg. Telamonia (Subgenus Telamonia)

Observer

baigl

Date

August 23, 2023 11:39 PM AKDT
Cortinarius Subg. Telamonia - Photo (c) mycowalt, some rights reserved (CC BY-SA), uploaded by mycowalt
sulcatus's ID: Cortinarius Subg. Telamonia (Subgenus Telamonia)
Added on March 16, 2024
Leading

Photos / Sounds

Observer

scottysmith

Date

August 19, 2023 02:56 PM AKDT
Cortinarius septentrionalis - Photo (c) Federico Calledda, some rights reserved (CC BY-NC), uploaded by Federico Calledda
sulcatus's ID: Cortinarius septentrionalis, a member of Cortinarius Sect. Myxacium (Section Myxacium)
Added on March 16, 2024
Improving

Photos / Sounds

What

Phlegmy Webcaps (Genus Phlegmacium)

Observer

sruffner

Date

July 27, 2023 11:35 AM PDT
Phlegmy Webcaps - Photo (c) Federico Calledda, some rights reserved (CC BY-NC), uploaded by Federico Calledda
sulcatus's ID: Phlegmy Webcaps (Genus Phlegmacium)
Added on March 15, 2024
Supporting

Photos / Sounds

What

Webcaps (Genus Cortinarius)

Observer

guy50

Date

December 18, 2023 12:40 PM PST

Description

Under Quercus chrysolepis

Cortinarius Sect. Phlegmacium - Photo (c) salvatore_bacciu_paola_mereu, some rights reserved (CC BY-NC), uploaded by salvatore_bacciu_paola_mereu
sulcatus's ID: Cortinarius Sect. Phlegmacium (Section Phlegmacium)
Added on March 14, 2024
Leading

Photos / Sounds

What

Webcaps (Genus Cortinarius)

Observer

guy50

Date

December 18, 2023 12:40 PM PST

Description

Under Quercus chrysolepis

Webcaps - Photo (c) Bruce Newhouse, some rights reserved (CC BY-NC-ND), uploaded by Bruce Newhouse
sulcatus's ID: Webcaps (Genus Cortinarius)
Added on March 14, 2024
Supporting

Photos / Sounds

What

Cortinarius Sect. Megaspori (Section Megaspori)

Observer

jonaleef

Date

November 8, 2023 03:30 PM PST
Cortinarius Subg. Telamonia - Photo (c) mycowalt, some rights reserved (CC BY-SA), uploaded by mycowalt
sulcatus's ID: Cortinarius Subg. Telamonia (Subgenus Telamonia)
Added on March 13, 2024
Improving

Photos / Sounds

What

Cortinarius Sect. Dermocybe (Section Dermocybe)

Observer

annepolyakov

Date

January 15, 2023

Description

TDM Collection II 16G

Cortinarius Sect. Dermocybe - Photo (c) Marco Floriani, some rights reserved (CC BY-NC), uploaded by Marco Floriani
sulcatus's ID: Cortinarius Sect. Dermocybe (Section Dermocybe)
Added on March 13, 2024
Leading

Photos / Sounds

What

Webcaps (Genus Cortinarius)

Observer

annepolyakov

Date

January 15, 2023

Description

TDM Collection II 29B

Webcaps - Photo (c) Bruce Newhouse, some rights reserved (CC BY-NC-ND), uploaded by Bruce Newhouse
sulcatus's ID: Webcaps (Genus Cortinarius)
Added on March 13, 2024
Leading

Photos / Sounds

What

Satin Shield (Pluteus plautus)

Observer

annepolyakov

Date

August 15, 2023
Deer Mushrooms - Photo (c) David Greenberger, some rights reserved (CC BY-NC-ND), uploaded by David Greenberger
sulcatus's ID: Deer Mushrooms (Genus Pluteus)
Added on March 13, 2024
Improving

Photos / Sounds

Date

December 15, 2023 10:03 AM PST

Description

This is the ITS1/2 for Cortinarius thiersii AAGGATCATTATTGAAATAAACCTGATGGGTTGCTGCTGGCTCTCTAGGGAGCATGTGCACACTTGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGATCTGGATATCTTTCTGAATGCCTGGCATTCGGGTTTGAGGATTGACTTTTGTCTTTCCTTACATTTCCAGGCCTATGTTTTCTTCATATACACCATTTATGTTATAGAATGTAATGAAAAGGGCCTTTGTGCCTACAAACCATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATCAACCTCCTCAGGTTTTAACTTGTCGAGTGTTTGGATGTGGGGGTCTTTTGCTGGTCTCTTTTGAGGTCGGCTCCCCTAAAATGCATTAGCGGAACAATTTGTTGACCCGTTCATTGGTGTGATAACTATCTACGCTTTTGACGTGAAACAGGTTCAGCTTCTAACAGTCCATTGACTTGGACAAATTTT

Cortinarius thiersii - Photo (c) noah_siegel, some rights reserved (CC BY-NC-SA), uploaded by noah_siegel
sulcatus's ID: Cortinarius thiersii, a member of Cortinarius Sect. Dermocybe (Section Dermocybe)
Added on March 13, 2024
Supporting

Photos / Sounds

Observer

drdick98229

Date

November 9, 2020 12:30 PM PST

Description

Under Douglas fir and western red cedar. Collection RHM-20-21, voucher WTU-F-073578.

Cortinarius zakii - Photo (c) RHMorrison, some rights reserved (CC BY-NC), uploaded by RHMorrison
sulcatus's ID: Cortinarius zakii, a member of Cortinarius Sect. Dermocybe (Section Dermocybe)
Added on March 13, 2024
Supporting

Photos / Sounds

What

Cortinarius Sect. Megaspori (Section Megaspori)

Observer

jonaleef

Date

November 8, 2023 03:30 PM PST
Webcaps - Photo (c) Bruce Newhouse, some rights reserved (CC BY-NC-ND), uploaded by Bruce Newhouse
sulcatus's ID: Webcaps (Genus Cortinarius)
Added on March 13, 2024
Supporting

Photos / Sounds

What

Cortinarius Subg. Telamonia (Subgenus Telamonia)

Observer

amberenergy

Date

October 20, 2019 01:45 PM CDT
Cortinarius Subg. Telamonia - Photo (c) mycowalt, some rights reserved (CC BY-SA), uploaded by mycowalt
sulcatus's ID: Cortinarius Subg. Telamonia (Subgenus Telamonia)
Added on March 12, 2024
Supporting

Stats

  • 2449

Gracias al apoyo de:

¿Quiere apoyarnos? Pregúntenos cómo escribiendo a snib.guatemala@gmail.com